top of page

Problem:

An RNA string is a string formed from the alphabet containing 'A', 'C', 'G', and 'U'. RNA does not have the base thymine (T), it is instead replaced with uracil (U).

Given a DNA string t corresponding to a coding strand, its transcribed RNA string u is formed by replacing all occurrences of 'T' in t with 'U' in u.

Given:  A file containing at most 1000 lines.

Return: A file containing all the even-numbered lines from the original file. Assume 1-based numbering of lines.

Sample Dataset: 

 

GATGGAACTTGACTACGTAAATT

Sample Output:   

 

GAUGGAACUUGACUACGUAAAUU

Solution:

We will use the replace( ) method to replace 'T' with 'U':

< >

string = "GATGGAACTTGACTACGTAAATT"

print(string.replace("T", "U"))

Output:

GAUGGAACUUGACUACGUAAAUU

Copy and paste the output you get from running your code on the sample data onto the Rosalind answer terminal and submit. Annnd get yourself a cookie!

Subscribe to my mailing list and never miss a blogpost or new puzzle!

  • White Instagram Icon

Thanks for submitting!

bottom of page