top of page

COUNTING DNA NUCLEOTIDES

Problem:

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of a length 21 DNA string is "ATGCTTCAGAAAGGTCTTAG"

Given:  A string s of length at most 10000 nucleotides.

Return:  Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s.

Sample Dataset: 

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output:  20 12 17 21

Solution:

To count the number of bases we will use the count ( ) method, which counts the number of occurrences of anything in a string. Using the method is really easy:

< >

text = "Oh, woeful, oh woeful, woeful, woeful day!"

print(text.count("woeful"))

4

So now we know how to use the count method we'll simply use it on the DNA string and format our answer beautifully:

< >

string = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"

 

print(string.count("A"), string.count("C"), string.count("G"), string.count("T"))

Output:

20 12 17 21

Copy and paste the output you get from running your code on the sample data onto the Rosalind answer terminal and submit. Annnd get yourself a cookie!

Subscribe to my mailing list and never miss a blogpost or new puzzle!

  • White Instagram Icon

Thanks for submitting!

bottom of page